Enter the sequence

# Example for substitution:
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTGGCGCGA(/T)GGCCGCCTGGCAACTCTGCGACTACTACCTGCC
# Example for inserttion:
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTG(+ATT)GCGCGAGGCCGCCTGGCAACTCTGCGACTACTACCTGCC
# Example for deletiion:
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGC(-GCTGGCGCGA)GGCCGCCTGGCAACTCTGCGACTACTACCTGCC
#The three examples above represent the input formats of three different editing types.The bases to be edited for each of the three editing types are all marked with a pair of parenthese().
#For base substitution,it is indicated by backslash "/",and the example is used to replace A with T.
#For base insertions are indicated by the plus sign "+",and the example indicates that ATT will be inserted at the parenthesis position
#Base deletions are indicated with a plus sign -. Examples indicate that GCTGGCGCGA will be deleted at the parenthesis position;

 

PAM   Maximum edit-to-nick distance     

Maximum PBS length   Maximum RTT length  

Minimum PBS length   Minimum RTT length  

NUMBER of optimal pegRNAS  Assembly  

MINIMUM NICK-TO-NICK DISTANCE  MAXIMUM NICK-TO-NICK DISTANCE 

MINIMUM DOWNSTREAM HOMOLOGY 

 

History
Input sequence PAM CUT SIZE MIN PBS MAX PBS MIN RT MAX RT MIN DIS SGRNA MAX DIS SGRNA HOMOLOGY Number show Time
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTGGCGCGA(/T)GGCCGCCTGGCAACTCTGCGACTACTACCTGCC NGG 10 8 17 8 24 0 100 5 10 20220921225004
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTGGCGCGA(/T)GGCCGCCTGGCAACTCTGCGACTACTACCTGCC NGG 10 8 17 8 24 0 100 5 10 20220918224757
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTGGCGCGA(/T)GGCCGCCTGGCAACTCTGCGACTACTACCTGCC NGG 10 8 17 8 24 0 100 5 10 20220906095028
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTGGCGCGA(/T)GGCCGCCTGGCAACTCTGCGACTACTACCTGCC NGG 10 8 17 8 24 0 100 5 10 20220905095746
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTG(+ATT)GCGCGAGGCCGCCTGGCAACTCTGCGACTACTACCTGC NGG 10 8 17 8 24 0 100 5 10 20220902161114
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTGGCGCGA(/T)GGCCGCCTGGCAACTCTGCGACTACTACCTGCC NGG 10 8 17 8 26 0 100 5 10 20220902161045
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTG(+ATT)GCGCGAGGCCGCCTGGCAACTCTGCGACTACTACCTGCC NGG 10 8 17 8 24 0 100 5 10 20220902155008
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTGGCGCGA(/T)GGCCGCCTGGCAACTCTGCGACTACTACCTGCC NGG 10 8 17 8 24 0 100 5 10 20220902154840
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTG(+ATC)GCGCGAGGCCGCCTGGCAACTCTGCGACTAC NGG 10 8 17 8 24 0 100 5 10 20220902154814
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTG(+ATT)GCGCGAGGCCGCCTGGCAACTCTGCGACTACTACCTGCC NGG 10 8 17 8 24 0 100 5 10 20220902154536