Enter the sequence

# Example for substitution:
# Example for inserttion:
# Example for deletiion:
#The three examples above represent the input formats of three different editing types.The bases to be edited for each of the three editing types are all marked with a pair of parenthese().
#For base substitution,it is indicated by backslash "/",and the example is used to replace A with T.
#For base insertions are indicated by the plus sign "+",and the example indicates that ATT will be inserted at the parenthesis position
#Base deletions are indicated with a plus sign -. Examples indicate that GCTGGCGCGA will be deleted at the parenthesis position;


PAM   Maximum edit-to-nick distance     

Maximum PBS length   Maximum RTT length  

Minimum PBS length   Minimum RTT length  

NUMBER of optimal pegRNAS  Assembly  




tgtgcgggccacgcgcctggaaggagaccaacatggc(/t)gcgcacccagatcctctgcagccacctggagggcca NGG 10 8 17 8 24 0 100 5 10 20230208090310