Enter the position

#The user enters the chromosome($chr) to be edited,the starting site($start_position),and the editing pattern($edit_pattern),where the editing pattern($edit_pattern) ,where
#the editing pattern begins with '/' ,'+' or '-' ,followed by the specific base sequence.
#If the editing mode starts with '/',it represents base replacement.For example,'/A' means that the base at the start site of chromosome is replacced with 'A' ( the replaced
#base and the replaced base cannot be the same,otherwise the operation is meaningless, and the following code will check and prompt)
# If the editing mode begins with '+', it indicates base insertion.For example,'+ATGCC' indicates that ATGCC is inserted after the base at the start site of the chromosome
#If the editing mode starts with '-',it represents base deletion.For example,'-GAG',it means deletion of 'GAG' after the base of the starting site of chromosome (the deleted se- #quence needs to exist,otherwise it cannot be deleted, and the following code will check and prompt)
#For example: for the user input chromosome start site chr1-943995(943995 is base 'C' and the next 20 consecutive bases are 'GAGAACTCGGCACAGGAGAG')
#If the 'C' on chr1-943995 is to be replaced with a 'T', then the user input edit mode is '/T'.
# If 'GTATT' is to be inserted after C on chr1-943995, then the user-entered edit mode is '+GTATT'.
#If 'GAGAACTCGG' is to be removed after 'C' on chr1-943995, then the user-entered edit mode is '-GAGAACTCGG'
#Also for PAM($pam_type), allows the user to choose on the web page which of the two is NGG or NG (default is NGG)
#For the maximum distance from the notch site to the edit site ($dis_nickase), allowing the user to choose the setting on the web page (default is 10)
#For the length range of PBS ($min_len_PBS, $max_len_PBS), give the user the option to set it on the web page (default is 8, 17 respectively)
#For the length range of RT ($min_len_RT, $max_len_RT), give the user the option to set it on the web page (default is 8, 24 respectively)

 

PAM   Maximum EDIT-TO-NICK DISTANCE     

Maximum PBS length   Maximum RTT length  

Minimum PBS length   Minimum RTT length  

NUMBER of optimal pegRNAS  Assembly  

MINIMUM NICK-TO-NICK DISTANCE  MAXIMUM NICK-TO-NICK DISTANCE  

MINIMUM DOWNSTREAM HOMOLOGY 

Chromosome
Start position
Editing pattern

 

History

{
CHR START_POSITION EDIT_PATTERN PAM CUT SIZE MIN PBS MAX PBS MIN RT MAX RT MIN DIS SGRNA MAX DIS SGRNA HOMOLOGY Number show Time
chr1 943995 -GAG NGG 10 8 17 8 24 0 100 5 10 20220921225150
chr1 943995 -GAg NGG 10 8 17 8 24 0 100 5 10 20220523202758
chr1 943995 +CAGCCCTGC NGG 10 8 17 8 24 0 100 5 10 20220513234444
chr1 943995 /T NGG 10 8 17 8 24 0 100 5 10 20220513144616
chr1 943995 +CAGCCCTGC NGG 10 8 17 8 24 0 100 5 10 20220513144556
chr1 943995 +CAGCCCTGC NGG 10 8 17 8 24 0 100 5 10 20220513144541
chr1 943995 +gga NGG 10 8 17 8 24 0 100 5 10 20220512215057
chr1 943995 /T NGG 10 8 17 8 24 0 100 5 10 20220512215043
chr1 943995 /T NGG 10 8 17 8 24 0 100 5 10 20220512214912
chr1 943995 /T NGG 10 8 17 8 24 0 100 5 10 20220512214556