Enter the sequence

# Example for substitution:
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTGGCGCGA(/T)GGCCGCCTGGCAACTCTGCGACTACTACCTGCC
# Example for inserttion:
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTG(+ATT)GCGCGAGGCCGCCTGGCAACTCTGCGACTACTACCTGCC
# Example for deletiion:
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGC(-GCTGGCGCGA)GGCCGCCTGGCAACTCTGCGACTACTACCTGCC
#The three examples above represent the input formats of three different editing types.The bases to be edited for each of the three editing types are all marked with a pair of parenthese().
#For base substitution,it is indicated by backslash "/",and the example is used to replace A with T.
#For base insertions are indicated by the plus sign "+",and the example indicates that ATT will be inserted at the parenthesis position
#Base deletions are indicated with a plus sign -. Examples indicate that GCTGGCGCGA will be deleted at the parenthesis position;

 

PAM   Maximum edit-to-nick distance     

Maximum PBS length   Maximum RTT length  

Minimum PBS length   Minimum RTT length  

NUMBER of optimal pegRNAS  Assembly  

MINIMUM NICK-TO-NICK DISTANCE  MAXIMUM NICK-TO-NICK DISTANCE 

MINIMUM DOWNSTREAM HOMOLOGY 

 

History

Download
Strand Spacer PAM PBS RTT EditToNickDistance sgRNASpacer sgRNAPAM NickToNickDistance Efficiency(%) Time
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCG GGCCTCGCGCAATCAGCG 6 GTAGTAGTCGCAGAGTTGCC AGG 22 22.403526306152344 20220902154536
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCG TCGCGCAATCAGCG 6 GTAGTAGTCGCAGAGTTGCC AGG 22 22.31026840209961 20220902154536
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCG GCCTCGCGCAATCAGCG 6 GTAGTAGTCGCAGAGTTGCC AGG 22 22.26366424560547 20220902154536
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCG CGCGCAATCAGCG 6 GTAGTAGTCGCAGAGTTGCC AGG 22 22.16425323486328 20220902154536
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCGG GGCCTCGCGCAATCAGCG 6 GTAGTAGTCGCAGAGTTGCC AGG 22 21.747648239135742 20220902154536
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCGG TCGCGCAATCAGCG 6 GTAGTAGTCGCAGAGTTGCC AGG 22 21.6887264251709 20220902154536
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCGG GCCTCGCGCAATCAGCG 6 GTAGTAGTCGCAGAGTTGCC AGG 22 21.613391876220703 20220902154536
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCGG CGCGCAATCAGCG 6 GTAGTAGTCGCAGAGTTGCC AGG 22 21.565902709960938 20220902154536
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCG CTCGCGCAATCAGCG 6 GTAGTAGTCGCAGAGTTGCC AGG 22 20.951187133789062 20220902154536
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCGG CTCGCGCAATCAGCG 6 GTAGTAGTCGCAGAGTTGCC AGG 22 20.752124786376953 20220902154536