Enter the sequence

# Example for substitution:
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTGGCGCGA(/T)GGCCGCCTGGCAACTCTGCGACTACTACCTGCC
# Example for inserttion:
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTG(+ATT)GCGCGAGGCCGCCTGGCAACTCTGCGACTACTACCTGCC
# Example for deletiion:
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGC(-GCTGGCGCGA)GGCCGCCTGGCAACTCTGCGACTACTACCTGCC
#The three examples above represent the input formats of three different editing types.The bases to be edited for each of the three editing types are all marked with a pair of parenthese().
#For base substitution,it is indicated by backslash "/",and the example is used to replace A with T.
#For base insertions are indicated by the plus sign "+",and the example indicates that ATT will be inserted at the parenthesis position
#Base deletions are indicated with a plus sign -. Examples indicate that GCTGGCGCGA will be deleted at the parenthesis position;

 

PAM   Maximum edit-to-nick distance     

Maximum PBS length   Maximum RTT length  

Minimum PBS length   Minimum RTT length  

NUMBER of optimal pegRNAS  Assembly  

MINIMUM NICK-TO-NICK DISTANCE  MAXIMUM NICK-TO-NICK DISTANCE 

MINIMUM DOWNSTREAM HOMOLOGY 

 

History

Download
Strand Spacer PAM PBS RTT EditToNickDistance sgRNASpacer sgRNAPAM NickToNickDistance Efficiency(%) Time
+ CCGAGGCTCACCCACACCAA GGG GTGTGGGT AGGGAATCCCCTTG 9 TTAAGAGAAGGGAATCCCCT TGG 5 22.73426055908203 20220613003850
+ CCGAGGCTCACCCACACCAA GGG GTGTGGGTG AGGGAATCCCCTTG 9 TTAAGAGAAGGGAATCCCCT TGG 5 22.29958724975586 20220613003850
+ CCGAGGCTCACCCACACCAA GGG GTGTGGGTGA AGGGAATCCCCTTG 9 TTAAGAGAAGGGAATCCCCT TGG 5 21.723098754882812 20220613003850
+ CCGAGGCTCACCCACACCAA GGG GTGTGGGT AAGGGAATCCCCTTG 9 TTAAGAGAAGGGAATCCCCT TGG 5 20.017749786376953 20220613003850
+ CCGAGGCTCACCCACACCAA GGG GTGTGGGTGAG AGGGAATCCCCTTG 9 TTAAGAGAAGGGAATCCCCT TGG 5 19.83799934387207 20220613003850
+ CCGAGGCTCACCCACACCAA GGG GTGTGGGTG AAGGGAATCCCCTTG 9 TTAAGAGAAGGGAATCCCCT TGG 5 19.663442611694336 20220613003850
+ CCGAGGCTCACCCACACCAA GGG GTGTGGGTGA AAGGGAATCCCCTTG 9 TTAAGAGAAGGGAATCCCCT TGG 5 19.310754776000977 20220613003850
+ GCCGAGGCTCACCCACACCA AGG TGTGGGTGAGC AAGGGAATCCCCTTGG 10 TTAAGAGAAGGGAATCCCCT TGG 6 19.246440887451172 20220613003850
+ GCCGAGGCTCACCCACACCA AGG TGTGGGTGAGCCTC GAAGGGAATCCCCTTGG 10 TTAAGAGAAGGGAATCCCCT TGG 6 19.123146057128906 20220613003850
+ GCCGAGGCTCACCCACACCA AGG TGTGGGTGAGC GAAGGGAATCCCCTTGG 10 TTAAGAGAAGGGAATCCCCT TGG 6 19.11982536315918 20220613003850