Enter the sequence

# Example for substitution:
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTGGCGCGA(/T)GGCCGCCTGGCAACTCTGCGACTACTACCTGCC
# Example for inserttion:
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTG(+ATT)GCGCGAGGCCGCCTGGCAACTCTGCGACTACTACCTGCC
# Example for deletiion:
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGC(-GCTGGCGCGA)GGCCGCCTGGCAACTCTGCGACTACTACCTGCC
#The three examples above represent the input formats of three different editing types.The bases to be edited for each of the three editing types are all marked with a pair of parenthese().
#For base substitution,it is indicated by backslash "/",and the example is used to replace A with T.
#For base insertions are indicated by the plus sign "+",and the example indicates that ATT will be inserted at the parenthesis position
#Base deletions are indicated with a plus sign -. Examples indicate that GCTGGCGCGA will be deleted at the parenthesis position;

 

PAM   Maximum edit-to-nick distance     

Maximum PBS length   Maximum RTT length  

Minimum PBS length   Minimum RTT length  

NUMBER of optimal pegRNAS  Assembly  

MINIMUM NICK-TO-NICK DISTANCE  MAXIMUM NICK-TO-NICK DISTANCE 

MINIMUM DOWNSTREAM HOMOLOGY 

 

History

Download
Strand Spacer PAM PBS RTT EditToNickDistance sgRNASpacer sgRNAPAM NickToNickDistance Efficiency(%) Time
+ GCCGGGGGGGCGCTGGCGCG AGG GCCAGCGCC AGGCGGCCACGC 4 GTAGTAGTCGCAGAGTTGCC AGG 15 16.89522933959961 20220511152952
+ GCCGGGGGGGCGCTGGCGCG AGG GCCAGCGCCC AGGCGGCCACGC 4 GTAGTAGTCGCAGAGTTGCC AGG 15 16.592683792114258 20220511152952
- GTAGTCGCAGAGTTGCCAGG CGG GGCAACTCTGC GGCGCGTGGCCGCCT 9 GGCGCTGGCGCGTGGCCGCC TGG 4 16.398435592651367 20220511152952
+ GCCGGGGGGGCGCTGGCGCG AGG GCCAGCGCC GGCGGCCACGC 4 GTAGTAGTCGCAGAGTTGCC AGG 15 16.340505599975586 20220511152952
+ GCCGGGGGGGCGCTGGCGCG AGG GCCAGCGCCC TGCCAGGCGGCCACGC 4 GTAGTAGTCGCAGAGTTGCC AGG 15 16.328683853149414 20220511152952
+ GCCGGGGGGGCGCTGGCGCG AGG GCCAGCGCCC GCCAGGCGGCCACGC 4 GTAGTAGTCGCAGAGTTGCC AGG 15 16.316375732421875 20220511152952
+ GCCGGGGGGGCGCTGGCGCG AGG GCCAGCGCCC GGCGGCCACGC 4 GTAGTAGTCGCAGAGTTGCC AGG 15 16.283472061157227 20220511152952
- GTAGTCGCAGAGTTGCCAGG CGG GGCAACTCTGC GCTGGCGCGTGGCCGCCT 9 GGCGCTGGCGCGTGGCCGCC TGG 4 16.264007568359375 20220511152952
+ GCCGGGGGGGCGCTGGCGCG AGG GCCAGCGCCC GCGGCCACGC 4 GTAGTAGTCGCAGAGTTGCC AGG 15 16.199302673339844 20220511152952
- GTAGTCGCAGAGTTGCCAGG CGG GGCAACTCTGCG GGCGCGTGGCCGCCT 9 GGCGCTGGCGCGTGGCCGCC TGG 4 16.18082046508789 20220511152952