Enter the sequence

# Example for substitution:
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTGGCGCGA(/T)GGCCGCCTGGCAACTCTGCGACTACTACCTGCC
# Example for inserttion:
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTG(+ATT)GCGCGAGGCCGCCTGGCAACTCTGCGACTACTACCTGCC
# Example for deletiion:
CGCCGCCGCCTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGC(-GCTGGCGCGA)GGCCGCCTGGCAACTCTGCGACTACTACCTGCC
#The three examples above represent the input formats of three different editing types.The bases to be edited for each of the three editing types are all marked with a pair of parenthese().
#For base substitution,it is indicated by backslash "/",and the example is used to replace A with T.
#For base insertions are indicated by the plus sign "+",and the example indicates that ATT will be inserted at the parenthesis position
#Base deletions are indicated with a plus sign -. Examples indicate that GCTGGCGCGA will be deleted at the parenthesis position;

 

PAM   Maximum edit-to-nick distance     

Maximum PBS length   Maximum RTT length  

Minimum PBS length   Minimum RTT length  

NUMBER of optimal pegRNAS  Assembly  

MINIMUM NICK-TO-NICK DISTANCE  MAXIMUM NICK-TO-NICK DISTANCE 

MINIMUM DOWNSTREAM HOMOLOGY 

 

History

Download
Strand Spacer PAM PBS RTT EditToNickDistance sgRNASpacer sgRNAPAM NickToNickDistance Efficiency(%) Time
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCG GAGTTGCCAGGCGGCCG 2 GTAGTAGTCGCAGAGTTGCC AGG 22 24.792991638183594 20220510143937
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCG AGTTGCCAGGCGGCCG 2 GTAGTAGTCGCAGAGTTGCC AGG 22 24.347707748413086 20220510143937
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCG AGAGTTGCCAGGCGGCCG 2 GTAGTAGTCGCAGAGTTGCC AGG 22 24.19675636291504 20220510143937
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCGG GAGTTGCCAGGCGGCCG 2 GTAGTAGTCGCAGAGTTGCC AGG 22 23.73509979248047 20220510143937
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCG GTTGCCAGGCGGCCG 2 GTAGTAGTCGCAGAGTTGCC AGG 22 23.733631134033203 20220510143937
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCGG AGTTGCCAGGCGGCCG 2 GTAGTAGTCGCAGAGTTGCC AGG 22 23.36627197265625 20220510143937
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCGG AGAGTTGCCAGGCGGCCG 2 GTAGTAGTCGCAGAGTTGCC AGG 22 23.247520446777344 20220510143937
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCGGC GAGTTGCCAGGCGGCCG 2 GTAGTAGTCGCAGAGTTGCC AGG 22 23.052900314331055 20220510143937
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCGG GTTGCCAGGCGGCCG 2 GTAGTAGTCGCAGAGTTGCC AGG 22 22.935985565185547 20220510143937
+ GCGTCAAGCCGGGGGGGCGC TGG CCCCCCCGGC AGAGTTGCCAGGCGGCCG 2 GTAGTAGTCGCAGAGTTGCC AGG 22 22.68877410888672 20220510143937