Welcome to OPEDVar!

QUERY TYPE Select query type and 'AlleleID','GeneID','GeneSymbol' and 'HGNC_ID' QUERY ITEM Enter the AlleleID,GeneID,GeneSymbol or HGNC_ID PAM Select PAM type between 'NGG' and 'NG' DIRECTION Select edit direction which means to install or correct pathogenic human genetic variants ASSEMBLY HISTORY

AlleleID Type Chromosome Start Stop ReferenceAllele AlternateAllele Spacer PBS RTT PAM
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAAT TCATCTCAGCCAAAA NGG
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAAT CATCTCAGCCAAAA NGG
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAA TCATCTCAGCCAAAA NGG
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAA CATCTCAGCCAAAA NGG
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAATT TCATCTCAGCCAAAA NGG
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAATT CATCTCAGCCAAAA NGG
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAAT TTCATCTCAGCCAAAA NGG
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAATTG TCATCTCAGCCAAAA NGG
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAATTG CATCTCAGCCAAAA NGG
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAA TTCATCTCAGCCAAAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCT CCGTATCTGAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCTT CCGTATCTGAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCTTG CCGTATCTGAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCT TTGGCCGTATCTGAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCTT TTGGCCGTATCTGAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCT GCCGTATCTGAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCT TGGCCGTATCTGAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCT GGCCGTATCTGAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCTT GCCGTATCTGAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCT ATTGGCCGTATCTGAA NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCTAGAAGTG GTCCTTGAAAACCTCGT NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCTAGAAG GTCCTTGAAAACCTCGT NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCTAGAAGT GTCCTTGAAAACCTCGT NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCTAG GTCCTTGAAAACCTCGT NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCTAGAA GTCCTTGAAAACCTCGT NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCTAGA GTCCTTGAAAACCTCGT NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCTA GTCCTTGAAAACCTCGT NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCT GTCCTTGAAAACCTCGT NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCTAGAAG AGTCCTTGAAAACCTCGT NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCTAGAA AGTCCTTGAAAACCTCGT NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATC CTATCCTCTA NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATCT CTATCCTCTA NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATCTG CTATCCTCTA NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATCTGT CTATCCTCTA NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATCTGTG CTATCCTCTA NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATCTGTGT CTATCCTCTA NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATC GCTATCCTCTA NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATCTGTGTT CTATCCTCTA NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATCTGTGTTT CTATCCTCTA NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATCTGTGTTTT CTATCCTCTA NGG
904301 single nucleotide variant 11 118472024 118472024 A T CTCAAGTCTAAGTTTAAGAC TTAAACTTAGACTTGA GAAGCTACCCTGTC NGG
904301 single nucleotide variant 11 118472024 118472024 A T CTCAAGTCTAAGTTTAAGAC TTAAACTTAGACTTGAG GAAGCTACCCTGTC NGG
904301 single nucleotide variant 11 118472024 118472024 A T CTCAAGTCTAAGTTTAAGAC TTAAACTTAGACTTGA TGAAGCTACCCTGTC NGG
904301 single nucleotide variant 11 118472024 118472024 A T CTCAAGTCTAAGTTTAAGAC TTAAACTTAGACTTGAG TGAAGCTACCCTGTC NGG
904301 single nucleotide variant 11 118472024 118472024 A T CTCAAGTCTAAGTTTAAGAC TTAAACTTAGACTTGAGA GAAGCTACCCTGTC NGG
904301 single nucleotide variant 11 118472024 118472024 A T CTCAAGTCTAAGTTTAAGAC TTAAACTTAGACTTG GAAGCTACCCTGTC NGG
904301 single nucleotide variant 11 118472024 118472024 A T TCAAGTCTAAGTTTAAGACA CTTAAACTTAGACTTG TGAAGCTACCCTGT NGG
904301 single nucleotide variant 11 118472024 118472024 A T CTCAAGTCTAAGTTTAAGAC TTAAACTTAGACTTGAGA TGAAGCTACCCTGTC NGG
904301 single nucleotide variant 11 118472024 118472024 A T CTCAAGTCTAAGTTTAAGAC TTAAACTTAGACTTG TGAAGCTACCCTGTC NGG
904301 single nucleotide variant 11 118472024 118472024 A T TCAAGTCTAAGTTTAAGACA CTTAAACTTAGACTTGA TGAAGCTACCCTGT NGG
511884 single nucleotide variant 11 118472681 118472681 G T GCAGTGGAGGATGAACTTCA AGTTCATCCTCC GAGCGATACCCCTTA NGG
511884 single nucleotide variant 11 118472681 118472681 G T GCAGTGGAGGATGAACTTCA AGTTCATCCTC GAGCGATACCCCTTA NGG
511884 single nucleotide variant 11 118472681 118472681 G T GCAGTGGAGGATGAACTTCA AGTTCATCCTCC GGAGCGATACCCCTTA NGG
511884 single nucleotide variant 11 118472681 118472681 G T GGCAGTGGAGGATGAACTTC GTTCATCCTCC GGAGCGATACCCCTTAA NGG
511884 single nucleotide variant 11 118472681 118472681 G T GGCAGTGGAGGATGAACTTC GTTCATCCTCCA GGAGCGATACCCCTTAA NGG
511884 single nucleotide variant 11 118472681 118472681 G T GCAGTGGAGGATGAACTTCA AGTTCATCCTC GCGATACCCCTTA NGG
511884 single nucleotide variant 11 118472681 118472681 G T GCAGTGGAGGATGAACTTCA AGTTCATCCTC AGCGATACCCCTTA NGG
511884 single nucleotide variant 11 118472681 118472681 G T GCAGTGGAGGATGAACTTCA AGTTCATCCTC GGAGCGATACCCCTTA NGG
511884 single nucleotide variant 11 118472681 118472681 G T GGCAGTGGAGGATGAACTTC GTTCATCCTCC GAGCGATACCCCTTAA NGG
511884 single nucleotide variant 11 118472681 118472681 G T GCAGTGGAGGATGAACTTCA AGTTCATCCTCCA GAGCGATACCCCTTA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCT CCCCCTAGCA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCTC CCCCCTAGCA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCTCC CCCCCTAGCA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCTCCT CCCCCTAGCA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCT CAAAGTGCCCCCTAGCA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCT GCCCCCTAGCA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCT GTGCCCCCTAGCA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCT AAAGTGCCCCCTAGCA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCT ACAAAGTGCCCCCTAGCA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCT AAGTGCCCCCTAGCA NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGC TTTTCACTTCCCTTGC NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGCA TTTTCACTTCCCTTGC NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGCAG TTTTCACTTCCCTTGC NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGCAGTGG GATTTTCACTTCCCTTGC NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGCAGTGGA TTTTCACTTCCCTTGC NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGCAGTGGA GATTTTCACTTCCCTTGC NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGCAGTGGA ATTTTCACTTCCCTTGC NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGCA ATTTTCACTTCCCTTGC NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGCAGTGG ATTTTCACTTCCCTTGC NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGCAGTGG TTTTCACTTCCCTTGC NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTCTGC CTGCTACCTTGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTCTGC TAGTCTGCTACCTTGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTCTGC AGTCTGCTACCTTGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTCTG CTGCTACCTTGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTCTGC ACTAGTCTGCTACCTTGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTCTGC CTAGTCTGCTACCTTGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTCT CTGCTACCTTGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTC CTGCTACCTTGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTCTGC GTCTGCTACCTTGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTC AGTCTGCTACCTTGG NGG
444729 single nucleotide variant 11 118473794 118473794 G T caagagtagagagagagacc CTCTCTCTCTACTCT CTCTCTACCGGT NGG
444729 single nucleotide variant 11 118473794 118473794 G T caagagtagagagagagacc CTCTCTCTCTACTC CTCTCTACCGGT NGG
444729 single nucleotide variant 11 118473794 118473794 G T caagagtagagagagagacc CTCTCTCTCTAC CTCTCTACCGGT NGG
444729 single nucleotide variant 11 118473794 118473794 G T caagagtagagagagagacc CTCTCTCTCT CTCTCTACCGGT NGG
444729 single nucleotide variant 11 118473794 118473794 G T acaagagtagagagagagac TCTCTCTCTACTC TTCTCTCTACCGGTC NGG
444729 single nucleotide variant 11 118473794 118473794 G T acaagagtagagagagagac TCTCTCTCTACTCT TTCTCTCTACCGGTC NGG
444729 single nucleotide variant 11 118473794 118473794 G T caagagtagagagagagacc CTCTCTCTCTACTCT TTCTCTCTACCGGT NGG
444729 single nucleotide variant 11 118473794 118473794 G T caagagtagagagagagacc CTCTCTCTCTACTC TTCTCTCTACCGGT NGG
444729 single nucleotide variant 11 118473794 118473794 G T caagagtagagagagagacc CTCTCTCTCTACT CTCTCTACCGGT NGG
444729 single nucleotide variant 11 118473794 118473794 G T caagagtagagagagagacc CTCTCTCTCTACTCTT CTCTCTACCGGT NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATGG CTGCCTAAG NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATGGA CTGCCTAAG NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATG CTGCCTAAG NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATGG TTGTCTGCCTAAG NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATGG TGTCTGCCTAAG NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATGGAG CTGCCTAAG NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATGG TGCCTAAG NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATGGA TGTCTGCCTAAG NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATGGA TGCCTAAG NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATGGA TTGTCTGCCTAAG NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGTC GTCCTCAC NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGTCT GTCCTCAC NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGTC GGTCCTCAC NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGT GTCCTCAC NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGTC GGGTCCTCAC NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGTCT GGTCCTCAC NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGT GGTCCTCAC NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGTCT GGGTCCTCAC NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGTC CGGGGTCCTCAC NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGT GGGTCCTCAC NGG
424701 single nucleotide variant 11 118476983 118476983 G A CTTCCATGGGGAATGATGGT ATCATTCCCC CTTGACCTATC NGG
424701 single nucleotide variant 11 118476983 118476983 G A CTTCCATGGGGAATGATGGT ATCATTCCC CTTGACCTATC NGG
424701 single nucleotide variant 11 118476983 118476983 G A CTTCCATGGGGAATGATGGT ATCATTCCCCA CTTGACCTATC NGG
424701 single nucleotide variant 11 118476983 118476983 G A TTGTCTTCCATGGGGAATGA TTCCCCATGGA TTGACCTATCATCA NGG
424701 single nucleotide variant 11 118476983 118476983 G A TTGTCTTCCATGGGGAATGA TTCCCCATGG TTGACCTATCATCA NGG
424701 single nucleotide variant 11 118476983 118476983 G A TTGTCTTCCATGGGGAATGA TTCCCCATGG TGACCTATCATCA NGG
424701 single nucleotide variant 11 118476983 118476983 G A CTTCCATGGGGAATGATGGT ATCATTCCCCATGGA CTTGACCTATC NGG
424701 single nucleotide variant 11 118476983 118476983 G A TTGTCTTCCATGGGGAATGA TTCCCCATGGA ACCTATCATCA NGG
424701 single nucleotide variant 11 118476983 118476983 G A TTGTCTTCCATGGGGAATGA TTCCCCATGGA TGACCTATCATCA NGG
424701 single nucleotide variant 11 118476983 118476983 G A TTGTCTTCCATGGGGAATGA TTCCCCATGG CTTGACCTATCATCA NGG
791105 single nucleotide variant 11 118478087 118478087 C A TAAAGAAAGGACGTCGATCG TCGACGTC CACCGCCTCTA NGG
791105 single nucleotide variant 11 118478087 118478087 C A TAAAGAAAGGACGTCGATCG TCGACGTCC CACCGCCTCTA NGG
421825 single nucleotide variant 11 118478105 118478105 G C GGACGTCGATCGAGGCGGTG CGCCTCGATCG CGGGAGACTGCCCACAC NGG
421825 single nucleotide variant 11 118478105 118478105 G C GTCCTCAGGCACCTGGCAGC GCCAGGTGCCTG GGGCAGTCTCCCGGCT NGG
421825 single nucleotide variant 11 118478105 118478105 G C GGACGTCGATCGAGGCGGTG CGCCTCGATCGA CGGGAGACTGCCCACAC NGG
421825 single nucleotide variant 11 118478105 118478105 G C GTCCTCAGGCACCTGGCAGC GCCAGGTGCCTG TGGGCAGTCTCCCGGCT NGG
421825 single nucleotide variant 11 118478105 118478105 G C GTCCTCAGGCACCTGGCAGC GCCAGGTGCC GGGCAGTCTCCCGGCT NGG
421825 single nucleotide variant 11 118478105 118478105 G C GTCCTCAGGCACCTGGCAGC GCCAGGTGCC TGGGCAGTCTCCCGGCT NGG
421825 single nucleotide variant 11 118478105 118478105 G C GTCCTCAGGCACCTGGCAGC GCCAGGTGCCT GGGCAGTCTCCCGGCT NGG
421825 single nucleotide variant 11 118478105 118478105 G C GGACGTCGATCGAGGCGGTG CGCCTCGAT CGGGAGACTGCCCACAC NGG
421825 single nucleotide variant 11 118478105 118478105 G C GTCCTCAGGCACCTGGCAGC GCCAGGTGCC GTGGGCAGTCTCCCGGCT NGG
421825 single nucleotide variant 11 118478105 118478105 G C GTCCTCAGGCACCTGGCAGC GCCAGGTGCCTG GTGGGCAGTCTCCCGGCT NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGG CACAGGCCTCAG NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGGC CACAGGCCTCAG NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGGCA CACAGGCCTCAG NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGGC CCACAGGCCTCAG NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGG CCACAGGCCTCAG NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGGCAG CACAGGCCTCAG NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGGCA CCACAGGCCTCAG NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGGCAGCCGGG CACAGGCCTCAG NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGGC ACCACAGGCCTCAG NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGGC CACCACAGGCCTCAG NGG
973777 single nucleotide variant 11 118480172 118480172 A G TTCTGACATTTTCTCATCCT ATGAGAAAATGTCA TTCCTGGG NGG
973777 single nucleotide variant 11 118480172 118480172 A G TTCTGACATTTTCTCATCCT ATGAGAAAATGTC TTCCTGGG NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACAT GGAAGGCATCCATTA NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACATT GGAAGGCATCCATTA NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACAT TGGAAGGCATCCATTA NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACA GGAAGGCATCCATTA NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACAT TTGGAAGGCATCCATTA NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACATT TGGAAGGCATCCATTA NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACATTT GGAAGGCATCCATTA NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACATT TTGGAAGGCATCCATTA NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACA TGGAAGGCATCCATTA NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACATTTTC GGAAGGCATCCATTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTC AACAACACTGCCTTTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTCT AACAACACTGCCTTTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTCTGC AACAACACTGCCTTTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTCTGC TAACAACACTGCCTTTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTC ACAACACTGCCTTTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTC TAACAACACTGCCTTTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTCTGCA AACAACACTGCCTTTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTCTGCAGG AACAACACTGCCTTTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTCT TAACAACACTGCCTTTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTCTGCAGG TAACAACACTGCCTTTA NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGCAA CTAGTTAGAAACCTACC NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGCA CTAGTTAGAAACCTACC NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGCAAG CTAGTTAGAAACCTACC NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGCAAGA CTAGTTAGAAACCTACC NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGC CTAGTTAGAAACCTACC NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGCAAGAG CTAGTTAGAAACCTACC NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGCAAGAGA CTAGTTAGAAACCTACC NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGCAAGA TCTAGTTAGAAACCTACC NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGCA TCTAGTTAGAAACCTACC NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGCAA TCTAGTTAGAAACCTACC NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATCAGG AAAAAGTAGCCTCCACCA NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATCAGG AAAAGTAGCCTCCACCA NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATCA AAAAGTAGCCTCCACCA NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATCA AAAAAGTAGCCTCCACCA NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATC AAAAGTAGCCTCCACCA NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATCAGGT AAAAAGTAGCCTCCACCA NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATC AAAAAGTAGCCTCCACCA NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATCAGGT AAAAGTAGCCTCCACCA NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATCAGGTG AAAAGTAGCCTCCACCA NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATCAGGTG AAAAAGTAGCCTCCACCA NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGGT CACTCAGCTGAT NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGG CACTCAGCTGAT NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGGTG CACTCAGCTGAT NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGGTG TCCTCACTCAGCTGAT NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGGTG CTCCTCACTCAGCTGAT NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGGTGG CTCCTCACTCAGCTGAT NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGGT TCCTCACTCAGCTGAT NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGGTGG TCCTCACTCAGCTGAT NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGGT TCACTCAGCTGAT NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGGT CTCCTCACTCAGCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGGT CACTCTCCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGG CACTCTCCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGGTG CACTCTCCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGGTGG CACTCTCCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGGT TCACTCTCCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGGTGGA CACTCTCCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGG TCACTCTCCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGGTG TCACTCTCCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGGT CTCACTCTCCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGGTGGAGG CACTCTCCTGAT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAGC GTGTATTACCAAGT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAGC TGTGTATTACCAAGT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAGC TTGTGTATTACCAAGT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAGCC TGTGTATTACCAAGT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAGCC GTGTATTACCAAGT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAGCC TTGTGTATTACCAAGT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAGCCC TGTGTATTACCAAGT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAG GTGTATTACCAAGT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAGCCCT TGTGTATTACCAAGT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAGCCC GTGTATTACCAAGT NGG
372204 single nucleotide variant 11 118489816 118489816 C T AGTTTGGTCCCAGGCACTCA GTGCCTGGGAC AGTGCTGAAACAGCTATCACCCTGA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGC TGGGTATCTTTA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGC GGGTATCTTTA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGCT GGGTATCTTTA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGCT TGGGTATCTTTA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGC TTGGGTATCTTTA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGCT TTGGGTATCTTTA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGCTT GGGTATCTTTA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGC TTTGGGTATCTTTA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGCTT TGGGTATCTTTA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGCT TTTGGGTATCTTTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTAC GGACTACCAGCCATTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTACC GGACTACCAGCCATTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTACC CGGACTACCAGCCATTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTACC TCGGACTACCAGCCATTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTACCG GGACTACCAGCCATTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTACCGGC GGACTACCAGCCATTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTACC CTCGGACTACCAGCCATTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTAC CGGACTACCAGCCATTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTAC GACTACCAGCCATTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTACC GACTACCAGCCATTA NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGAC GCAATGGGCTGCCAAGC NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGAC GGCAATGGGCTGCCAAGC NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGAC TGGCAATGGGCTGCCAAGC NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGACT GCAATGGGCTGCCAAGC NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGACT GGCAATGGGCTGCCAAGC NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGACT TGGCAATGGGCTGCCAAGC NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGACTT GCAATGGGCTGCCAAGC NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGACTT GGCAATGGGCTGCCAAGC NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGAC CTGGCAATGGGCTGCCAAGC NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGACTT TGGCAATGGGCTGCCAAGC NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTCA AAATTTAAAAAGCCAACA NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTC AAATTTAAAAAGCCAACA NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTCAAG AAATTTAAAAAGCCAACA NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTCAAGT AAATTTAAAAAGCCAACA NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTCAA AAATTTAAAAAGCCAACA NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTCAAGTC AAATTTAAAAAGCCAACA NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTCA GAAATTTAAAAAGCCAACA NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTCAAG GAAATTTAAAAAGCCAACA NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTC GAAATTTAAAAAGCCAACA NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTCAA GAAATTTAAAAAGCCAACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCAA TAAAAAAGCCTACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCA AAGCCTACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCAA AAAAGCCTACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCAA AAGCCTACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCAA AAAAAAGCCTACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCAA AAAAAGCCTACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCAA TTAAAAAAGCCTACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCAA AAAGCCTACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCA AAAGCCTACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCA AAAAGCCTACA NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAAC GTGTTCCTGAG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAAC TGTGTTCCTGAG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAACT GTGTTCCTGAG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAACTG GTGTTCCTGAG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAACTGTG GTGTTCCTGAG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAACTGTGT GTGTTCCTGAG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAACT TGTGTTCCTGAG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAACTGT GTGTTCCTGAG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAACTG TGTGTTCCTGAG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAAC TGTTCCTGAG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGAT AAGTATATTGCCAATG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGAT AGTATATTGCCAATG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGATT AAGTATATTGCCAATG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGATT AGTATATTGCCAATG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGAT GTATATTGCCAATG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGATT GTATATTGCCAATG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGAT AAAGTATATTGCCAATG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGA AAGTATATTGCCAATG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGATTT AAGTATATTGCCAATG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGA AGTATATTGCCAATG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGGTAA CTGGCTGTTGACCGTTG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGG CTGGCTGTTGACCGTTG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGGTAA GGCTGTTGACCGTTG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGGTAA TGGCTGTTGACCGTTG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGGTA CTGGCTGTTGACCGTTG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGGT CTGGCTGTTGACCGTTG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGG TGGCTGTTGACCGTTG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGG GGCTGTTGACCGTTG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGGT TGGCTGTTGACCGTTG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGGTAAA GGCTGTTGACCGTTG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGGAT GCTTCAAAGTCCAGAG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGGA GCTTCAAAGTCCAGAG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGGA ATGCTTCAAAGTCCAGAG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGGAT ATGCTTCAAAGTCCAGAG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGGA TGCTTCAAAGTCCAGAG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGGAT TGCTTCAAAGTCCAGAG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGGA AATGCTTCAAAGTCCAGAG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGG GCTTCAAAGTCCAGAG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGGAT AATGCTTCAAAGTCCAGAG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGGATC GCTTCAAAGTCCAGAG NGG
408286 single nucleotide variant 11 118502656 118502656 C A AAAGTAGTTGATCATGTCTT ACATGATCAACT GTACTTTAATTCAGTGGCCCTAAG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCAAATGGA GTCTCAATCATTCCTTTG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCAAATGGA GGTCTCAATCATTCCTTTG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCA GTCTCAATCATTCCTTTG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCAA GTCTCAATCATTCCTTTG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCAAATGG GTCTCAATCATTCCTTTG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCAAAT GTCTCAATCATTCCTTTG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCAAATGG GGTCTCAATCATTCCTTTG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCAAATGGAG GTCTCAATCATTCCTTTG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCAAA GTCTCAATCATTCCTTTG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCAAATGGAGG GTCTCAATCATTCCTTTG NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTACC AATGATCGAGACTAACA NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTAC AATGATCGAGACTAACA NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTACCCA AATGATCGAGACTAACA NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTACCCAA AATGATCGAGACTAACA NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTACC GAATGATCGAGACTAACA NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTACCC AATGATCGAGACTAACA NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTACC GGAATGATCGAGACTAACA NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTAC ATGATCGAGACTAACA NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTAC GAATGATCGAGACTAACA NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTACCCAAT AATGATCGAGACTAACA NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACAA GAGTATATGGGCCAATG NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACA GAGTATATGGGCCAATG NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACAAT GAGTATATGGGCCAATG NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACA GTATATGGGCCAATG NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACAA GTATATGGGCCAATG NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACAA AGTATATGGGCCAATG NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACAA TGAGTATATGGGCCAATG NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACA AGTATATGGGCCAATG NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACA TGAGTATATGGGCCAATG NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACAATG GAGTATATGGGCCAATG NGG
168858 single nucleotide variant 11 118503723 118503723 G T TCCAGATGGCCCCAAACCTC GTTTGGGGC CATCCTACTGAG NGG
168858 single nucleotide variant 11 118503723 118503723 G T TCCAGATGGCCCCAAACCTC GTTTGGGGCCATCTGG CATCCTACTGAG NGG
168858 single nucleotide variant 11 118503723 118503723 G T TCCAGATGGCCCCAAACCTC GTTTGGGGCCATCTG CATCCTACTGAG NGG
168858 single nucleotide variant 11 118503723 118503723 G T AGATGGCCCCAAACCTCAGG GAGGTTTGGGG CCATCCTACT NGG
168858 single nucleotide variant 11 118503723 118503723 G T TCCAGATGGCCCCAAACCTC GTTTGGGGCCATCTGGA CATCCTACTGAG NGG
168858 single nucleotide variant 11 118503723 118503723 G T AGATGGCCCCAAACCTCAGG GAGGTTTGGGG CATCCTACT NGG
168858 single nucleotide variant 11 118503723 118503723 G T TCCAGATGGCCCCAAACCTC GTTTGGGGCCATCTGGAA CATCCTACTGAG NGG
168858 single nucleotide variant 11 118503723 118503723 G T AGATGGCCCCAAACCTCAGG GAGGTTTGGG CCATCCTACT NGG
168858 single nucleotide variant 11 118503723 118503723 G T TCCAGATGGCCCCAAACCTC GTTTGGGGCC CATCCTACTGAG NGG
168858 single nucleotide variant 11 118503723 118503723 G T AGATGGCCCCAAACCTCAGG GAGGTTTGGG CATCCTACT NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAG CTTGCCTCAC NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAGT GCTGATCTCTTGCCTCAC NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAGT AGCTGATCTCTTGCCTCAC NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAGT CTTGCCTCAC NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAGT TGCCTCAC NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAGT GATCTCTTGCCTCAC NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAGTTG AGCTGATCTCTTGCCTCAC NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAG TGCCTCAC NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAGT TGATCTCTTGCCTCAC NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAGTT GCTGATCTCTTGCCTCAC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAGA CAGTCATTCCTCTC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAGAA CAGTCATTCCTCTC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAG CAGTCATTCCTCTC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAGAAA CAGTCATTCCTCTC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAGAAAT CAGTCATTCCTCTC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAGA CCAGTCATTCCTCTC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAGAA CCAGTCATTCCTCTC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAGAA GCCAGTCATTCCTCTC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAGAAATC CAGTCATTCCTCTC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAGAAA CCAGTCATTCCTCTC NGG
371262 single nucleotide variant 11 118504462 118504462 T A TCACCCAAAGCCTGCATGGA ATGCAGGCT TGTACAAAAGAATACTCCATCC NGG
371262 single nucleotide variant 11 118504462 118504462 T A TCACCCAAAGCCTGCATGGA ATGCAGGC TGTACAAAAGAATACTCCATCC NGG
371262 single nucleotide variant 11 118504462 118504462 T A TCACCCAAAGCCTGCATGGA ATGCAGGCTTTGGG TGTACAAAAGAATACTCCATCC NGG
371262 single nucleotide variant 11 118504462 118504462 T A TCACCCAAAGCCTGCATGGA ATGCAGGCT TTGTACAAAAGAATACTCCATCC NGG
371262 single nucleotide variant 11 118504462 118504462 T A TCACCCAAAGCCTGCATGGA ATGCAGGCTTTGG TGTACAAAAGAATACTCCATCC NGG
371262 single nucleotide variant 11 118504462 118504462 T A TCACCCAAAGCCTGCATGGA ATGCAGGC TTGTACAAAAGAATACTCCATCC NGG
371262 single nucleotide variant 11 118504462 118504462 T A TCACCCAAAGCCTGCATGGA ATGCAGGCTT TGTACAAAAGAATACTCCATCC NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAGA CTGTTCCCATCT NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAGAA CTGTTCCCATCT NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAG CTGTTCCCATCT NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAGAAG CTGTTCCCATCT NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAGA TGTTCCCATCT NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAGAAGT CTGTTCCCATCT NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAGAA TGTTCCCATCT NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAGA ACTGTTCCCATCT NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAGAAG TGTTCCCATCT NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAGAA ACTGTTCCCATCT NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCCC CAGAACTAGAA NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCC CAGAACTAGAA NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCCCA CAGAACTAGAA NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCCC CCAGAACTAGAA NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCC CCAGAACTAGAA NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCCCAA CAGAACTAGAA NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCCCA CCAGAACTAGAA NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCCCAAT CAGAACTAGAA NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCCCAATTCTA CAGAACTAGAA NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCCCAA CCAGAACTAGAA NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCAAC TACTTAATCTCACCGAAC NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCAACA TACTTAATCTCACCGAAC NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCAACAT TACTTAATCTCACCGAAC NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCA TACTTAATCTCACCGAAC NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCAAC ATACTTAATCTCACCGAAC NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCAA TACTTAATCTCACCGAAC NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCAACA ATACTTAATCTCACCGAAC NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCAACATCA TACTTAATCTCACCGAAC NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCAACATC TACTTAATCTCACCGAAC NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCAACAT ATACTTAATCTCACCGAAC NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGTAC GCTTATTCAGCCAATA NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGTA TTATTCAGCCAATA NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGT TTATTCAGCCAATA NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGTA GCTTATTCAGCCAATA NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGTACC GCTTATTCAGCCAATA NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGTAC TGCTTATTCAGCCAATA NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGTAC TTATTCAGCCAATA NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGT GCTTATTCAGCCAATA NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGTAC CTTATTCAGCCAATA NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGTACC TGCTTATTCAGCCAATA NGG
444735 single nucleotide variant 11 118506063 118506063 C T CAGGCTGGTCCTGAATCCCC GATTCAGGACCAG AGCCAGTAGAGCCTGGG NGG
444735 single nucleotide variant 11 118506063 118506063 C T CAGGCTGGTCCTGAATCCCC GATTCAGGACC TAGCCAGTAGAGCCTGGG NGG
444735 single nucleotide variant 11 118506063 118506063 C T CAGGCTGGTCCTGAATCCCC GATTCAGGACCAG TAGCCAGTAGAGCCTGGG NGG
444735 single nucleotide variant 11 118506063 118506063 C T CAGGCTGGTCCTGAATCCCC GATTCAGGACCA TAGCCAGTAGAGCCTGGG NGG
259977 single nucleotide variant 11 118506109 118506109 C A GTCTGTGATGTCCCCAGTTG CTGGGGAC AAGTTAAGGAATGTTTCCACAA NGG
259977 single nucleotide variant 11 118506109 118506109 C A GTCTGTGATGTCCCCAGTTG CTGGGGAC CAAGTTAAGGAATGTTTCCACAA NGG
259977 single nucleotide variant 11 118506109 118506109 C A GTCTGTGATGTCCCCAGTTG CTGGGGAC GCCAAGTTAAGGAATGTTTCCACAA NGG
259977 single nucleotide variant 11 118506109 118506109 C A GTCTGTGATGTCCCCAGTTG CTGGGGAC CCAAGTTAAGGAATGTTTCCACAA NGG
259977 single nucleotide variant 11 118506109 118506109 C A GTCTGTGATGTCCCCAGTTG CTGGGGACA AAGTTAAGGAATGTTTCCACAA NGG
259977 single nucleotide variant 11 118506109 118506109 C A GTCTGTGATGTCCCCAGTTG CTGGGGAC CGCCAAGTTAAGGAATGTTTCCACAA NGG
259977 single nucleotide variant 11 118506109 118506109 C A GTCTGTGATGTCCCCAGTTG CTGGGGACA CAAGTTAAGGAATGTTTCCACAA NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGAC CACACTACTTCT NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGACT CACACTACTTCT NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGACTG CACACTACTTCT NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGAC ACACTACTTCT NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGACTG ACACTACTTCT NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGACT ACACTACTTCT NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGAC CCACACTACTTCT NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGACT CCACACTACTTCT NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGACTGC CACACTACTTCT NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGACTG CCACACTACTTCT NGG
439883 single nucleotide variant 11 118510119 118510119 G A ATCTGTGCAGAAAGTATTGA ATACTTTCTGCACA AATCCACTCATCTTCA NGG
439883 single nucleotide variant 11 118510119 118510119 G A ATCTGTGCAGAAAGTATTGA ATACTTTCTGCACAG AATCCACTCATCTTCA NGG
439883 single nucleotide variant 11 118510119 118510119 G A ATCTGTGCAGAAAGTATTGA ATACTTTCTGCACAG ATCCACTCATCTTCA NGG
439883 single nucleotide variant 11 118510119 118510119 G A ATCTGTGCAGAAAGTATTGA ATACTTTCTGCAC AATCCACTCATCTTCA NGG
439883 single nucleotide variant 11 118510119 118510119 G A ATCTGTGCAGAAAGTATTGA ATACTTTCTGCACA ATCCACTCATCTTCA NGG
439883 single nucleotide variant 11 118510119 118510119 G A ATCTGTGCAGAAAGTATTGA ATACTTTCTGCACA TAATCCACTCATCTTCA NGG
439883 single nucleotide variant 11 118510119 118510119 G A ATCTGTGCAGAAAGTATTGA ATACTTTCTGCACAG TAATCCACTCATCTTCA NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAAAT GTCAATCACTTCCAGGC NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAAA GTCAATCACTTCCAGGC NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAAAT TCAATCACTTCCAGGC NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAAA TCAATCACTTCCAGGC NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAAAT TGTCAATCACTTCCAGGC NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAAATA GTCAATCACTTCCAGGC NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAAA TGTCAATCACTTCCAGGC NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAAATA TCAATCACTTCCAGGC NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAA GTCAATCACTTCCAGGC NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAA TCAATCACTTCCAGGC NGG
514622 single nucleotide variant 11 118511989 118511989 C T GTCATTGACAGATAAAGTCC CTTTATCTGTCAATGACT TGATCAAGCTTCCTGGA NGG
514622 single nucleotide variant 11 118511989 118511989 C T GTCATTGACAGATAAAGTCC CTTTATCTGTCAATGAC TGATCAAGCTTCCTGGA NGG
514622 single nucleotide variant 11 118511989 118511989 C T GTCATTGACAGATAAAGTCC CTTTATCTGTCAATGA TGATCAAGCTTCCTGGA NGG
514622 single nucleotide variant 11 118511989 118511989 C T GTCATTGACAGATAAAGTCC CTTTATCTGTCAAT TGATCAAGCTTCCTGGA NGG
514622 single nucleotide variant 11 118511989 118511989 C T GTCATTGACAGATAAAGTCC CTTTATCTGTCAATG TGATCAAGCTTCCTGGA NGG
514622 single nucleotide variant 11 118511989 118511989 C T GTCATTGACAGATAAAGTCC CTTTATCTGTCAATGAC TTGATCAAGCTTCCTGGA NGG
514622 single nucleotide variant 11 118511989 118511989 C T GTCATTGACAGATAAAGTCC CTTTATCTGTCAATGACT TTGATCAAGCTTCCTGGA NGG
514622 single nucleotide variant 11 118511989 118511989 C T GTCATTGACAGATAAAGTCC CTTTATCTGTCAATGA TTGATCAAGCTTCCTGGA NGG
514622 single nucleotide variant 11 118511989 118511989 C T GTCATTGACAGATAAAGTCC CTTTATCTGTCAA TGATCAAGCTTCCTGGA NGG
514622 single nucleotide variant 11 118511989 118511989 C T AAATGAGAGCTGCTTTAGGC TAAAGCAGCTCTCA AAGCTTGATCAAATGCCCGCC NGG
973770 Deletion 11 118436819 118436819 GC G gtcctcagcctcttcAGGGC CTGAAGAGG CAGGGCCGCC NGG
973770 Deletion 11 118436819 118436819 GC G gtcctcagcctcttcAGGGC CTGAAGAGGC CAGGGCCGCC NGG
805668 Deletion 11 118503014 118503014 AT A CATTCCTTTGCCCTCTCAAA GAGAGGGC CCTCCATT NGG
444734 Deletion 11 118505275 118505275 AT A ACTTCAGTATTGGGACCCAT GGTCCCAA CCTCCCTG NGG