OPEDVar

QUERY TYPE Select query type and 'AlleleID','GeneID',
'GeneSymbol' and 'HGNC_ID' QUERY ITEM Enter the AlleleID,GeneID,GeneSymbol or HGNC_ID PAM Select PAM type between 'NGG' and 'NG' DIRECTION Select edit direction which means to install
or correct pathogenic human genetic variants ASSEMBLY
HISTORY

Download
AlleleID Type Chromosome Start Stop ReferenceAllele AlternateAllele Spacer PBS RTT PAM
929884 single nucleotide variant 1 943995 943995 C T CTACGTGGCCAGCTTCCCCG GGAAGCTGGCC CTGCTCTCCTGTGCCGAGTTCTCACTCCGGGGCCCGCAGGGTTGGTGGCTGCAGTGGCAGAGCCACGG NGG
929884 single nucleotide variant 1 943995 943995 C T CTACGTGGCCAGCTTCCCCG GGAAGCTGGCC TGCTCTCCTGTGCCGAGTTCTCACTCCGGGGCCCGCAGGGTTGGTGGCTGCAGTGGCAGAGCCACGG NGG
929884 single nucleotide variant 1 943995 943995 C T GCCACCAACCCTGCGGGCCC CCCGCAGGG TTCTCACTCCGGGG NGG
929884 single nucleotide variant 1 943995 943995 C T CTACGTGGCCAGCTTCCCCG GGAAGCTGGCC GCTCTCCTGTGCCGAGTTCTCACTCCGGGGCCCGCAGGGTTGGTGGCTGCAGTGGCAGAGCCACGG NGG
929884 single nucleotide variant 1 943995 943995 C T CTACGTGGCCAGCTTCCCCG GGAAGCTGGCC TTCTCACTCCGGGGCCCGCAGGGTTGGTGGCTGCAGTGGCAGAGCCACGG NGG
929884 single nucleotide variant 1 943995 943995 C T GCCACCAACCCTGCGGGCCC CCCGCAGG TTCTCACTCCGGGG NGG
929884 single nucleotide variant 1 943995 943995 C T CTACGTGGCCAGCTTCCCCG GGAAGCTGGCC GTTCTCACTCCGGGGCCCGCAGGGTTGGTGGCTGCAGTGGCAGAGCCACGG NGG
929884 single nucleotide variant 1 943995 943995 C T CTACGTGGCCAGCTTCCCCG GGAAGCTGGCCA CTGCTCTCCTGTGCCGAGTTCTCACTCCGGGGCCCGCAGGGTTGGTGGCTGCAGTGGCAGAGCCACGG NGG
929884 single nucleotide variant 1 943995 943995 C T CTACGTGGCCAGCTTCCCCG GGAAGCTGGCC CTCTCCTGTGCCGAGTTCTCACTCCGGGGCCCGCAGGGTTGGTGGCTGCAGTGGCAGAGCCACGG NGG
929884 single nucleotide variant 1 943995 943995 C T CTACGTGGCCAGCTTCCCCG GGAAGCTGGCC AGTTCTCACTCCGGGGCCCGCAGGGTTGGTGGCTGCAGTGGCAGAGCCACGG NGG